d20ato

1

7 marzo 2013 di thesurvivaldiaries

Passati stramesi da ultima.

Notyetto scrivo bene, pensare rapido. Il cortice è grambagato di furore. Mi mulina una serie di stuff da leccarsi. Eine augenblick bitte.

Daijobu, credo.

Missili saranno bellissimi e lago di Garda. Il mostro sale dalla terra sottacqua, visto la morte salire dalla terra, le pecore elettriche sognano soylent green. Anacott acciaio, canistracci oil, mia moglie era una strega ed è morta sul rogo.

Arké. Io canto il corpo olografico, vergine madre, figlia del proprio figlio, umile e alta, fulmine di pegasus, mi portò a conoscere il ghiaccio, magna tuto attaccano posto di casa Jesolo.

Amore muore.

Magna tuto troppi. So many i had not thought death had undone so many.

Estote non parati.

Corrono i miei. Sui tetti a fare sogeki, da balconi fucili a pompa magna, brividi di luce, loro con bazuki, armi automatiche, otto defender verdi, non leggo il loro libro, magnifici bastardi, usquarna, Kawasaki, girano attorno al precint con urla che salivano fino al cielo e pioveva.

Ame ka?

Area odia al quadrato. Area ha sentito ha letto ha visto ha postato video.

Marcello mi aveva detto all of this, avvertito.

Vengono su per le scale come sanguisughe sul cazzo del tizio. O sei come loro o sei carne. Sei comunque carne, credo. La carne è brutta perché fa male. Ho paura, mamma.

Non ho potuto fare nulla mentre tutti cadevano.

No. Non che nulla proprio.

D20ato.

Ricordare Sant’erasmo mon amour.

Ho ucciso tutti e sono morto. Unfuckinbelievable.

Tutta boccetta. A garganeeeella, mi. Mai così tanta dovete, se prendete. Una buona giornata da un po’ di tempo, you can’t understand a user’s mind, but try with your book and degrees. Sarebbe meglio che ti pompassi come me. Ma no come me. Ne ho presa troppa amico.

Il prigioniero ha una scimmia sulla schiena.

La scimmia urla al cielo.

Tutto è uno.

Preso uomini come grissini, tonno del capitano barbanera, pallottole come matrix, scie, vedi tutto ma non è che sei tu che vedi perché tu non esisti. Tu sei tutto e tutto è uno.

Ora che la scimmia è scesa un poco, capisco what’s d20 it’s all about.

In grado di dare la morte. Critico ad ogni lancio. You can’t stat chtulu. Sanity -60. Morte probabile, inferno sicuro, cinture ben allacciate, fari accesi anche di giorno.

Sono diventato la morte, il distruttore di mondi. Mastro Lindo.

Poi vagato si accendono e si spengono gli alberi di natale.

Tutti morti. Chloe morta.

È stata la scimmia che urla e che mi tiene una catena stretta al collo. Sono utile, ma non per molto, il futuro sta arrivando.

Vagato. Ultimo segnale visto: Bigdoors. Portegrandi.

Sono vicino.

No tanto bene.

Negozio computer. Portatile corrente scritto.

Mangiato un cane buono. Mano ho visto che prendeva, mugolo e poi preso e mangiato.

La scimmia ora va giù, i say, i hope.

I’m disable, come Sebna, prima di me.

Se guardo uno specchio vedo Dio Cane. Ora mi ficco nei campi. Uccido tutti zulu che posso. Anche non zulu, non importa. C’è una città sepolta sotto il lago di Garda. Ho visto le luci, come quando vedi una cosa che non riesci a vedere ma sai che la stai guardando. Pompe. Macchine. Burobureau. Serpente che mangia la coda. Neverending. Samsara. Saliscendi. Lucine che fanno bip, abbiamo pagato un po’ per quelle. Sequenziatori di DNA. Chiarissimo. ATATCGACGAGCCAGTTTACG e altre cattive idee.

Lì sta il Vecchio e dorme. Non è morto, non è vivo, non è zulu, non è d20ato. È una cosa diversa. Ma dorme.

Rosa è la sua bodyguard. Lei fa i mostri.

Adesso vado a prendere una bomba atomica. Sotto Vicenza. Adesso te la sparo nel culo Area. Hai ucciso Chloe.

Prova a prendermi mentre stampo i soldi per pagare quel che resta della tua anima.

Altro d20. Trovare altro d20. Untori che leggete. Datemi altro d20. Portatemi altro d20.

Non in condizione parlare più.

Save our souls.

One thought on “d20ato

  1. […] È successo tempo fa, subito dopo quella che credevo la mia prima esperienza col D20. Quel post strano che ho deciso di non cancellare, ve lo ricordate? Bé. Guile, sulla spiaggia, mi aveva detto che […]

Rispondi

Inserisci i tuoi dati qui sotto o clicca su un'icona per effettuare l'accesso:

Logo WordPress.com

Stai commentando usando il tuo account WordPress.com. Chiudi sessione / Modifica )

Foto Twitter

Stai commentando usando il tuo account Twitter. Chiudi sessione / Modifica )

Foto di Facebook

Stai commentando usando il tuo account Facebook. Chiudi sessione / Modifica )

Google+ photo

Stai commentando usando il tuo account Google+. Chiudi sessione / Modifica )

Connessione a %s...

eBook – Stagione 1

Promo

BlogItalia - La directory italiana dei blog
%d blogger hanno fatto clic su Mi Piace per questo: